MCMR results

Overview of mec3_t1_4 results from ../runs/mec3_t1_4_sqlite.db

82 total motifs, 31 were grouped into 10 cliques with 51 singletons

Run Overview

RunID	Program	Fasta (nseq)	Nmotifs
12012	ALIGNACE	mec3_top20o_u2_2_19.fa (59)	17
12016	WEEDER	mec3_top20o_u2_2_19.fa (59)	6
12020	IMPROBIZER	mec3_top20o_u2_2_19.fa (59)	10
12024	MEME	mec3_top20o_u2_2_19.fa (59)	10
12028	NMICA	mec3_top20o_u2_2_19.fa (59)	4
12032	MOBYDICK	mec3_top20o_u2_2_19.fa (59)	10
12036	MOTIFSAMPLER	mec3_top20o_u2_2_19.fa (59)	5
12040	YMF	mec3_top20o_u2_2_19.fa (59)	10

By Clique

clique 0 had 5 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

cATGCATg	52 matches in 26 regions(gba	motif 4 from WEEDER run 12016 (ID 20)	mec3_top20o_u2_2_19.fa list
tAATGCATTa	22 matches in 13 regions(gba	motif 5 from WEEDER run 12016 (ID 21)	mec3_top20o_u2_2_19.fa list
CtctGtgcACaAatGcATtTaTTctTGCaTTTGagAGgacgGaTGgc	4 matches in 4 regions(gba	motif 6 from MEME run 12024 (ID 38)	mec3_top20o_u2_2_19.fa list
ATGCAT	53 matches in 34 regions(gba	motif 4 from MOBYDICK run 12032 (ID 50)	mec3_top20o_u2_2_19.fa list
AATGCAT	56 matches in 29 regions(gba	motif 8 from MOBYDICK run 12032 (ID 54)	mec3_top20o_u2_2_19.fa list

clique 1 had 5 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

CtCCtCCCtCtctt	37 matches in 25 regions(gba	motif 8 from ALIGNACE run 12012 (ID 7)	mec3_top20o_u2_2_19.fa list
CcCcCtctctCtc	33 matches in 21 regions(gba	motif 12 from ALIGNACE run 12012 (ID 11)	mec3_top20o_u2_2_19.fa list
CCCCccCcCtc	11 matches in 8 regions(gba	motif 3 from YMF run 12040 (ID 64)	mec3_top20o_u2_2_19.fa list
CCCCCtcCt	15 matches in 9 regions(gba	motif 9 from YMF run 12040 (ID 70)	mec3_top20o_u2_2_19.fa list
CCCCcCtcCt	15 matches in 12 regions(gba	motif 10 from YMF run 12040 (ID 71)	mec3_top20o_u2_2_19.fa list

clique 2 had 4 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

CGtGgCGAGACC	12 matches in 10 regions(gba	motif 13 from ALIGNACE run 12012 (ID 12)	mec3_top20o_u2_2_19.fa list
CctgtaAatCGacagacaaTCGtGGcGAGACCCggggggcg	7 matches in 7 regions(gba	motif 4 from MEME run 12024 (ID 36)	mec3_top20o_u2_2_19.fa list
GGCGAGACCC	6 matches in 6 regions(gba	motif 1 from YMF run 12040 (ID 62)	mec3_top20o_u2_2_19.fa list
CGtGgCGAGAC	9 matches in 8 regions(gba	motif 7 from YMF run 12040 (ID 68)	mec3_top20o_u2_2_19.fa list

clique 3 had 4 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

CCGCC	63 matches in 38 regions(gba	motif 3 from MOBYDICK run 12032 (ID 49)	mec3_top20o_u2_2_19.fa list
CCGCCC	26 matches in 21 regions(gba	motif 6 from MOBYDICK run 12032 (ID 52)	mec3_top20o_u2_2_19.fa list
CCGCCCA	13 matches in 13 regions(gba	motif 7 from MOBYDICK run 12032 (ID 53)	mec3_top20o_u2_2_19.fa list
TCCGCCCA	8 matches in 8 regions(gba	motif 10 from MOBYDICK run 12032 (ID 56)	mec3_top20o_u2_2_19.fa list

clique 4 had 3 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

GAAGA	426 matches in 57 regions(gba	motif 1 from MOBYDICK run 12032 (ID 47)	mec3_top20o_u2_2_19.fa list
AGAAGA	179 matches in 51 regions(gba	motif 5 from MOBYDICK run 12032 (ID 51)	mec3_top20o_u2_2_19.fa list
aAGaAGAAG	45 matches in 26 regions(gba	motif 4 from YMF run 12040 (ID 65)	mec3_top20o_u2_2_19.fa list

clique 5 had 2 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

	gaGaCaCAGAcAaATGActcCcccgcttCtaAGGaTtaGcTcTC		6 matches in 6 regions(gba	motif 5 from MEME run 12024 (ID 37)	mec3_top20o_u2_2_19.fa list
	CCCCC		73 matches in 36 regions(gba	motif 2 from MOBYDICK run 12032 (ID 48)	mec3_top20o_u2_2_19.fa list

clique 6 had 2 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

	aaaaggaAGAGacgaagagag		32 matches in 32 regions(gba	motif 2 from IMPROBIZER run 12020 (ID 24)	mec3_top20o_u2_2_19.fa list
	AGAGACGCAG		7 matches in 7 regions(gba	motif 8 from YMF run 12040 (ID 69)	mec3_top20o_u2_2_19.fa list

clique 7 had 2 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

	aaAAaaaGAAaA		160 matches in 51 regions(gba	motif 3 from ALIGNACE run 12012 (ID 2)	mec3_top20o_u2_2_19.fa list
	AAAaAgAAgAAg		85 matches in 35 regions(gba	motif 3 from WEEDER run 12016 (ID 19)	mec3_top20o_u2_2_19.fa list

clique 8 had 2 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

	CtCctCcc		96 matches in 53 regions(gba	motif 4 from MOTIFSAMPLER run 12036 (ID 60)	mec3_top20o_u2_2_19.fa list
	CTCCtCCCAC		9 matches in 8 regions(gba	motif 5 from YMF run 12040 (ID 66)	mec3_top20o_u2_2_19.fa list

clique 9 had 2 motifs (list mec3_top20o_u2_2_19.fa 59) gba for all members

Core: table

	AATgcATT		127 matches in 42 regions(gba	motif 1 from WEEDER run 12016 (ID 17)	mec3_top20o_u2_2_19.fa list
	AAATGCAT		34 matches in 24 regions(gba	motif 9 from MOBYDICK run 12032 (ID 55)	mec3_top20o_u2_2_19.fa list

Run 12012 was ALIGNACE on mec3_top20o_u2_2_19.fa (59)

aAAAAattaaaAAAa	264 matches in 54 regions(gba	motif 1 from ALIGNACE run 12012 (ID 0)	mec3_top20o_u2_2_19.fa list
aAAAAaaaaaaaaattttaAaAa	210 matches in 56 regions(gba	motif 2 from ALIGNACE run 12012 (ID 1)	mec3_top20o_u2_2_19.fa list
aaAAaaaGAAaA	160 matches in 51 regions(gba	motif 3 from ALIGNACE run 12012 (ID 2)	mec3_top20o_u2_2_19.fa list
gAaAAaAAaaaa	159 matches in 52 regions(gba	motif 4 from ALIGNACE run 12012 (ID 3)	mec3_top20o_u2_2_19.fa list
TtTGaAAAatt	106 matches in 46 regions(gba	motif 5 from ALIGNACE run 12012 (ID 4)	mec3_top20o_u2_2_19.fa list
AAAAaTtaatTTT	78 matches in 43 regions(gba	motif 6 from ALIGNACE run 12012 (ID 5)	mec3_top20o_u2_2_19.fa list
AAAAttTgaA	85 matches in 35 regions(gba	motif 7 from ALIGNACE run 12012 (ID 6)	mec3_top20o_u2_2_19.fa list
CtCCtCCCtCtctt	37 matches in 25 regions(gba	motif 8 from ALIGNACE run 12012 (ID 7)	mec3_top20o_u2_2_19.fa list
ctaAaattatCTGAAAa	20 matches in 15 regions(gba	motif 9 from ALIGNACE run 12012 (ID 8)	mec3_top20o_u2_2_19.fa list
gaaaaGagAaGAagaa	72 matches in 37 regions(gba	motif 10 from ALIGNACE run 12012 (ID 9)	mec3_top20o_u2_2_19.fa list
TGcATTTgtgA	33 matches in 25 regions(gba	motif 11 from ALIGNACE run 12012 (ID 10)	mec3_top20o_u2_2_19.fa list
CcCcCtctctCtc	33 matches in 21 regions(gba	motif 12 from ALIGNACE run 12012 (ID 11)	mec3_top20o_u2_2_19.fa list
CGtGgCGAGACC	12 matches in 10 regions(gba	motif 13 from ALIGNACE run 12012 (ID 12)	mec3_top20o_u2_2_19.fa list
GaGaGaaggaGaga	38 matches in 26 regions(gba	motif 14 from ALIGNACE run 12012 (ID 13)	mec3_top20o_u2_2_19.fa list
aAaTTTCAAA	25 matches in 21 regions(gba	motif 15 from ALIGNACE run 12012 (ID 14)	mec3_top20o_u2_2_19.fa list
AAAAATGgAa	32 matches in 22 regions(gba	motif 16 from ALIGNACE run 12012 (ID 15)	mec3_top20o_u2_2_19.fa list
gACAtCtGGagg	17 matches in 15 regions(gba	motif 17 from ALIGNACE run 12012 (ID 16)	mec3_top20o_u2_2_19.fa list

Run 12016 was WEEDER on mec3_top20o_u2_2_19.fa (59)

AATgcATT	127 matches in 42 regions(gba	motif 1 from WEEDER run 12016 (ID 17)	mec3_top20o_u2_2_19.fa list
ATgcATTTtT	78 matches in 37 regions(gba	motif 2 from WEEDER run 12016 (ID 18)	mec3_top20o_u2_2_19.fa list
AAAaAgAAgAAg	85 matches in 35 regions(gba	motif 3 from WEEDER run 12016 (ID 19)	mec3_top20o_u2_2_19.fa list
cATGCATg	52 matches in 26 regions(gba	motif 4 from WEEDER run 12016 (ID 20)	mec3_top20o_u2_2_19.fa list
tAATGCATTa	22 matches in 13 regions(gba	motif 5 from WEEDER run 12016 (ID 21)	mec3_top20o_u2_2_19.fa list
AaATgcATtT	39 matches in 16 regions(gba	motif 6 from WEEDER run 12016 (ID 22)	mec3_top20o_u2_2_19.fa list

Run 12020 was IMPROBIZER on mec3_top20o_u2_2_19.fa (59)

ggaagagtGGGcGGaGc	29 matches in 29 regions(gba	motif 1 from IMPROBIZER run 12020 (ID 23)	mec3_top20o_u2_2_19.fa list
aaaaggaAGAGacgaagagag	32 matches in 32 regions(gba	motif 2 from IMPROBIZER run 12020 (ID 24)	mec3_top20o_u2_2_19.fa list
gaaaaGGcGgaag	45 matches in 45 regions(gba	motif 3 from IMPROBIZER run 12020 (ID 25)	mec3_top20o_u2_2_19.fa list
atcAcaCACt	49 matches in 49 regions(gba	motif 4 from IMPROBIZER run 12020 (ID 26)	mec3_top20o_u2_2_19.fa list
tgTaTGtAT	50 matches in 50 regions(gba	motif 5 from IMPROBIZER run 12020 (ID 27)	mec3_top20o_u2_2_19.fa list
actGgtGctC	51 matches in 51 regions(gba	motif 6 from IMPROBIZER run 12020 (ID 28)	mec3_top20o_u2_2_19.fa list
ACaGTAAc	40 matches in 40 regions(gba	motif 7 from IMPROBIZER run 12020 (ID 29)	mec3_top20o_u2_2_19.fa list
AGaAGaG	37 matches in 37 regions(gba	motif 8 from IMPROBIZER run 12020 (ID 30)	mec3_top20o_u2_2_19.fa list
taGAaGACg	50 matches in 50 regions(gba	motif 9 from IMPROBIZER run 12020 (ID 31)	mec3_top20o_u2_2_19.fa list
atAtAgtGa	50 matches in 50 regions(gba	motif 10 from IMPROBIZER run 12020 (ID 32)	mec3_top20o_u2_2_19.fa list

Run 12024 was MEME on mec3_top20o_u2_2_19.fa (59)

ttttttttctttttttttccctTtTtctc	58 matches in 58 regions(gba	motif 1 from MEME run 12024 (ID 33)	mec3_top20o_u2_2_19.fa list
TtTTTTTCAga	56 matches in 56 regions(gba	motif 2 from MEME run 12024 (ID 34)	mec3_top20o_u2_2_19.fa list
ACAATACGAAAAAGCGAGCACAAACATTCAATTACGCGTAACCGTATTTG	3 matches in 3 regions(gba	motif 3 from MEME run 12024 (ID 35)	mec3_top20o_u2_2_19.fa list
CctgtaAatCGacagacaaTCGtGGcGAGACCCggggggcg	7 matches in 7 regions(gba	motif 4 from MEME run 12024 (ID 36)	mec3_top20o_u2_2_19.fa list
gaGaCaCAGAcAaATGActcCcccgcttCtaAGGaTtaGcTcTC	6 matches in 6 regions(gba	motif 5 from MEME run 12024 (ID 37)	mec3_top20o_u2_2_19.fa list
CtctGtgcACaAatGcATtTaTTctTGCaTTTGagAGgacgGaTGgc	4 matches in 4 regions(gba	motif 6 from MEME run 12024 (ID 38)	mec3_top20o_u2_2_19.fa list
tctCcgTTgccaGtCGAGcCtCaagacagcCgTTCCaccagtgatccgc	4 matches in 4 regions(gba	motif 7 from MEME run 12024 (ID 39)	mec3_top20o_u2_2_19.fa list
tcaaAAAAaaaaaaAAaAaAt	56 matches in 56 regions(gba	motif 8 from MEME run 12024 (ID 40)	mec3_top20o_u2_2_19.fa list
CaTCgGaAAACTgGcCAACTTCAGCGAACACtCtGTaTC	3 matches in 3 regions(gba	motif 9 from MEME run 12024 (ID 41)	mec3_top20o_u2_2_19.fa list
GAttGcaTGgTaAAAcaTggCaaaTGTTTGtcATccgaTGGgttGGgtcg	3 matches in 3 regions(gba	motif 10 from MEME run 12024 (ID 42)	mec3_top20o_u2_2_19.fa list

Run 12028 was NMICA on mec3_top20o_u2_2_19.fa (59)

tTtTgAAAAa	122 matches in 44 regions(gba	motif 1 from NMICA run 12028 (ID 43)	mec3_top20o_u2_2_19.fa list
ttcgAAaTTt	212 matches in 54 regions(gba	motif 2 from NMICA run 12028 (ID 44)	mec3_top20o_u2_2_19.fa list
TtTTtCAgAa	82 matches in 40 regions(gba	motif 3 from NMICA run 12028 (ID 45)	mec3_top20o_u2_2_19.fa list
TTTTCAgata	81 matches in 39 regions(gba	motif 4 from NMICA run 12028 (ID 46)	mec3_top20o_u2_2_19.fa list

Run 12032 was MOBYDICK on mec3_top20o_u2_2_19.fa (59)

GAAGA	426 matches in 57 regions(gba	motif 1 from MOBYDICK run 12032 (ID 47)	mec3_top20o_u2_2_19.fa list
CCCCC	73 matches in 36 regions(gba	motif 2 from MOBYDICK run 12032 (ID 48)	mec3_top20o_u2_2_19.fa list
CCGCC	63 matches in 38 regions(gba	motif 3 from MOBYDICK run 12032 (ID 49)	mec3_top20o_u2_2_19.fa list
ATGCAT	53 matches in 34 regions(gba	motif 4 from MOBYDICK run 12032 (ID 50)	mec3_top20o_u2_2_19.fa list
AGAAGA	179 matches in 51 regions(gba	motif 5 from MOBYDICK run 12032 (ID 51)	mec3_top20o_u2_2_19.fa list
CCGCCC	26 matches in 21 regions(gba	motif 6 from MOBYDICK run 12032 (ID 52)	mec3_top20o_u2_2_19.fa list
CCGCCCA	13 matches in 13 regions(gba	motif 7 from MOBYDICK run 12032 (ID 53)	mec3_top20o_u2_2_19.fa list
AATGCAT	56 matches in 29 regions(gba	motif 8 from MOBYDICK run 12032 (ID 54)	mec3_top20o_u2_2_19.fa list
AAATGCAT	34 matches in 24 regions(gba	motif 9 from MOBYDICK run 12032 (ID 55)	mec3_top20o_u2_2_19.fa list
TCCGCCCA	8 matches in 8 regions(gba	motif 10 from MOBYDICK run 12032 (ID 56)	mec3_top20o_u2_2_19.fa list

Run 12036 was MOTIFSAMPLER on mec3_top20o_u2_2_19.fa (59)

CtcCtccC	85 matches in 47 regions(gba	motif 1 from MOTIFSAMPLER run 12036 (ID 57)	mec3_top20o_u2_2_19.fa list
CtctCtCc	89 matches in 48 regions(gba	motif 2 from MOTIFSAMPLER run 12036 (ID 58)	mec3_top20o_u2_2_19.fa list
GgagccgC	69 matches in 46 regions(gba	motif 3 from MOTIFSAMPLER run 12036 (ID 59)	mec3_top20o_u2_2_19.fa list
CtCctCcc	96 matches in 53 regions(gba	motif 4 from MOTIFSAMPLER run 12036 (ID 60)	mec3_top20o_u2_2_19.fa list
tCTcCtcC	87 matches in 48 regions(gba	motif 4 from MOTIFSAMPLER run 12036 (ID 61)	mec3_top20o_u2_2_19.fa list

Run 12040 was YMF on mec3_top20o_u2_2_19.fa (59)

GGCGAGACCC	6 matches in 6 regions(gba	motif 1 from YMF run 12040 (ID 62)	mec3_top20o_u2_2_19.fa list
CCCCcCCCCt	7 matches in 5 regions(gba	motif 2 from YMF run 12040 (ID 63)	mec3_top20o_u2_2_19.fa list
CCCCccCcCtc	11 matches in 8 regions(gba	motif 3 from YMF run 12040 (ID 64)	mec3_top20o_u2_2_19.fa list
aAGaAGAAG	45 matches in 26 regions(gba	motif 4 from YMF run 12040 (ID 65)	mec3_top20o_u2_2_19.fa list
CTCCtCCCAC	9 matches in 8 regions(gba	motif 5 from YMF run 12040 (ID 66)	mec3_top20o_u2_2_19.fa list
CTCTcccTCTC	12 matches in 8 regions(gba	motif 6 from YMF run 12040 (ID 67)	mec3_top20o_u2_2_19.fa list
CGtGgCGAGAC	9 matches in 8 regions(gba	motif 7 from YMF run 12040 (ID 68)	mec3_top20o_u2_2_19.fa list
AGAGACGCAG	7 matches in 7 regions(gba	motif 8 from YMF run 12040 (ID 69)	mec3_top20o_u2_2_19.fa list
CCCCCtcCt	15 matches in 9 regions(gba	motif 9 from YMF run 12040 (ID 70)	mec3_top20o_u2_2_19.fa list
CCCCcCtcCt	15 matches in 12 regions(gba	motif 10 from YMF run 12040 (ID 71)	mec3_top20o_u2_2_19.fa list